the answer is B. Enzymes :)
Answer:
it is enzymes
Explanation: i just answered it
Figure 10-4
49
replicate DNA
a
In Figure 10-4. what role does structure A play in mitosis?
b. increase cell
connect to spindled dissolve nuclear
volume
fibers
envelope
Figure 10-5
Structure A in Figure 10-4 is the centrioles. role does structure A play in mitosis is: (c) connect to spindle fibers
Centrioles are paired organelles that are found in the cytoplasm of eukaryotic cells. They are composed of microtubules, which are long, thin filaments that form the structural framework of the cell. During interphase, the centrioles are located near the nucleus and are surrounded by a cloud of protein called the centrosome.
As the cell progresses into mitosis, the centrioles replicate and move to opposite poles of the cell. This process is called centrosome separation. The centrosomes act as organizing centers for the spindle fibers, which are microtubules that extend from the centrosomes and attach to the chromosomes. The spindle fibers play a crucial role in separating the chromosomes during mitosis.
The action by which a plant grows toward sunlight is called _____.
response to stimulus
using energy
reproduction
movement
Answer: phototropism
Explanation: phototropism is a plant's response to light.
Plants growing toward sunlight is known as tropism, a response to stimuli.
Tropism is the action by which a plant grows toward sunlight. This growth movement is a response to stimuli where the plant or a part of it grows in the direction from which the stimulus originates.
need help plzzzzzzzz In this assessment, you will categorize a group of animals by two forms of classification: phylogeny (cladistics) and Linnaean taxonomy. For phylogeny, you will create a cladogram for your groups of animals. For Linnaean classification, you will create a taxonomy chart or concept map that categorizes your species by taxa. Select from the two groups of animals listed below for your project.
Bird Group: Blue Jay, robin, cardinal, finch, and pelican
Insect Group: African honeybee, grasshopper, black widow spider, mosquito, and yellow jacket
Answer:
Blue Jay
Kingdom: Animalia
Phylum: Chordata
Class: Aves
Order: Passeriformes
Family: Corvidae
Genus: Cyanocitta
Species: C. cristata
Robin
Kingdom: Animalia
Phylum: Chordata
Class: Aves
Order: Passeriformes
Family: Turdidae
Genus: Turdus
Species: T. migratorius
Cardinal
Kingdom: Animalia
Phylum: Chordata
Class: Aves
Order: Passeriformes
Suborder: Passeri
Family: Cardinalidae
Finch
Kingdom: Animalia
Phylum: Chordata
Class: Reptilia
Class: Aves
Order: Passeriformes
Superfamily: Passeroidea
Family: Fringillidae
Pelican
Kingdom: Animalia
Phylum: Chordata
Class: Aves
Order: Pelecaniformes
Family: Pelecanidae
Genus: Pelecanus
Explanation:
I put it into the graph they want, and I got a 100%. (If your in FLVS like me, try to re-word it or put it in a different setting.)
The two groups of animals listed below for your project are as follow:
1. Blue Jay
Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PasseriformesFamily: CorvidaeGenus: CyanocittaSpecies: C. cristata2. Robin
Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PasseriformesFamily: TurdidaeGenus: TurdusSpecies: T. migratorius3. Cardinal
Kingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PasseriformesSuborder: PasseriFamily: Cardinalidae4. Finch
Kingdom: AnimaliaPhylum: ChordataClass: ReptiliaClass: AvesOrder: PasseriformesSuperfamily: PasseroideaFamily: FringillidaeKingdom: AnimaliaPhylum: ChordataClass: AvesOrder: PelecaniformesFamily: PelecanidaeGenus: PelecanusWhat is animal classification chart?Kingdom, phylum, class, order, family, genus, and species are the classification levels in order.
Thus, this the answer.
To learn more about animal classification click here:
https://brainly.com/question/24095327
#SPJ2
The function of the eardrum is to
Answer:
A. carry the sound energy to the brain. B. collect the sound waves. C. amplify the received sound. D. vibrate with the frequency of the received sound.
These are the choices right? Well, I think that its D. vibrate with the frequency of the received sound. I hope its correct bc im on the same question.. good luck:) {MARK BRAINLIEST!!!}
The two immediate functions of the eardrum are auditory and protective.
The eardrum is the membrane of the middle year which vibrates in response to sound waves; also the tympanic membrane.
How can we protect(s) the eardrum from dirt?The earwax is the part of the ear that protects the eardrums from dirt and infections. These are produced by glands in the skin linings of the ear canal responsible for protecting the ear. The ear is divided into three sections: Outer, middle, and inner ear.
Earwax is found in the outer ear section lining the ear canal protecting the passage to the eardrum.
Earwax when removed in excessive amounts may cause the ears to develop certain infections and might cause the infections of the other sections of the ears as well.
Thus, this could be the answer.
To learn more about eardrum click here:
https://brainly.com/question/13740969
#SPJ2
an increase in skin cancer can be traced to a decrease in atmospheric
Answer:
an increase in skin cancer can be traced to a decrease in atmospheric ozone.
Happy to help
pls mark as Brainliest
Answer: Ozone
Explanation: There is a increase in chance of cancer now a days as compared to earlier time because of ozone depletion.
Due to various types of human activities there are many holes in the ozone due to which harmful ultraviolet rays is entering on earth and there is an increase in the chances o skin cancer.
So, the correct answer is ozone
Frost wedging happens when__
Answer:
Frost wedging occurs as the result of expansion of water when it is converted to ice. Cracks filled with water are forced further apart when it freezes.
Answer: The correct option is water freezes inside a rock, causing it to break
Explanation:
Which part of a mushroom can you see above the ground?
Answer:
The correct answer is reproductive part.
Explanation:
The mushroom belongs to the family of fungus. It is composed of two parts one underground part called as mycellium and the other part which can be seen above the ground. This part is the reproductive part of mushroom which is often edible. The other parts of the mushroom includes stem, hypae, volva, spores, gill, ring cap. There are variety of mushrooms available but all the forms are not eatable some of them are poisonous to human health.
In order from less complex to more complex, which level of organization is directly after tissue?
Elements. Knowledge of basic science includes the distinction between atoms and molecules, and elements, mixtures and compounds. ...
Molecules. The size of molecules varies enormously depending on the type of molecule.
Organelles.
Cells.
Tissues.
Organs.
Organ Systems.
Organism.
Answer:
a
Explanation:
hope it helps
what are two ways variation in the trait could be introduced into the population?
A single mutation can have a large effect, but in many cases, evolutionary change is based on the accumulation of many mutations. I hope this help you
Answer:
i sai sai
Explanation:
sia sia sai In a running relay, each runner ran an equal part of the total distance. Joseph and 3 othe
The four principles of natural selection
1) Variation: there needs to be a difference in the individuals within a population
2) Inheritance: These variable traits must be able to be passed down genetically
3) Growth rate: There needs to be a growth rate that requires a struggle for resources
4) Survival rate: There needs to be a difference in survival rate for the different variation types... certain variations will live
The four principles of natural selection are variation, inheritance, high rate of population growth, and differential survival and reproduction. This means members of a species are variable, part of this variation is inheritable, populations produce more offspring than can survive, and those with better survival traits are more likely to pass them on.
Explanation:The four principles of natural selection are: variation, inheritance, high rate of population growth, and differential survival and reproduction.
The principal of variation means individuals within species are variable. Inheritance means that some of these variations are passed on to offspring. High rate of population growth means that populations produce more offspring than can survive, leading to competition. Lastly, differential survival and reproduction states that individuals with advantageous traits are more likely survive and reproduce than those without these traits.
Combined, these principles drive the process of natural selection, causing species to adapt to their environments over time. In any given environment, the individuals with traits best suited to that environment will have the greatest chances of surviving and passing those traits on to the next generation.
Learn more about Natural Selection here:https://brainly.com/question/32227158
#SPJ6
I need help now
Which type of bacteria is shown in the image?
A. bacillus
B. coccus
C. spirillum
D. cholera
Answer is B bacillus
The bacteria shown in the image are bacillus bacteria. Therefore, option A is correct.
Bacillus bacteria are a group of rod-shaped, gram-positive bacteria that belong to the genus Bacillus. They are characterized by their ability to form endospores, which are dormant structures that allow them to survive in harsh conditions. Bacillus bacteria are widely distributed in nature and can be found in soil, water, and various organic materials.
Some notable species of Bacillus include Bacillus subtilis, Bacillus cereus, and Bacillus anthracis. Therefore, option A is correct.
Learn more about Bacillus bacteria, here:
https://brainly.com/question/11201874
#SPJ4
The information contained in the table could be used _______________________.
Can you attach the table so I can see it??
Answer:
A
Explanation:
to establish the degree of relatedness among these organisms The more similar the DNA, the greater the degree of relatedness, or the more recent in time the two organisms diverged from a common ancestor. If there is a great difference in DNA sequencing, this suggests that the organisms shared a common ancestor a long time ago.
Linnaeus is considered the "Father of _____." Modern Taxonomy Botany Zoology
Answer:taxonomy
Explanation:
Modern Taxonomy
Carolus Linnaeus it credited with developing the scientific naming and classification system.
Hope this helps!!
How is an egg fertilized in flowering plants?
A.
with sperm
B.
by spores
C.
with an ovule
D.
with embryos
Answer: A. with sperm
Explanation:
There are several problems with classifying organisms into six kingdoms of life. One problem is that _______ aren't well defined and are very diverse. In addition, any eukaryotes that don't fit into other kingdoms are placed in this kingdom. A. fungi B. plants C. archaea D. protists
Answer:
D. Protists
Explanation:
Kingdom protista is composed of mostly unicellular organisms, but they do include some multicellular organisms. Like your problem says, eukaryotes that do not fit in other kingdoms are placed in this kingdom. As a result, even members of this kingdom do not share many similarities, as the organisms here are diverse.
The answer is D. Protists
Why do geese fly together in a V formation?
Explanation:
Geese fly together in a v formation.
Geese fly together because when the first goose flaps it's wings it creates an upward force which make it easier for the second goose to fly.
In this way the force increases and the effort the last goose has to spend to fly decreases a lot.
Hope it helps you.
please mark as brainliest.
Answer:
B. to save energy
Explanation:
ody ssey Unit 3, Assignment 2. Animal behavior and Interdependencies, page 4, under Group Animal Behavior, paragraph 2, from " The lead goose....V formation.....making their flight easier."
nowhere in my ody ssey unit materials did it mention otherwise or geese again.
(WILL MARK BRAINLIEST, I NEED HELP URGENTLY)
What is the DNA Sequence, Resulting mRNA sequence, Complementary tRNA
sequence, and Resulting Amino Acid sequence
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
What happens to a virus involved in the lysogenic cycle?
Answer:
The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell. The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within.
please, answer the question immediately as it is important for my project. the motions of comets and asteroids in our solar system are predictable because they are
1)smaller than planets
2)nearly spherical in shape
3)in orbit around the sun
4)controlled by earth's gravity
I think its 3)in orbit around the sun
i hope i helped even just a little :)
3) in orbit around the sun.
The motions of comets and asteroids in our solar system are predictable because they are in orbit around the sun.Asteroids are rocky. They come from the inner solar system, where any ice would have been baked off by the sun long ago. Their orbits are fairly predictable. That means new comets can arrive in the inner solar system ,something we have no way of predicting ahead of time.Asteroid revolves around the Sun in elliptical orbits.Learn more:
brainly.com/question/17717852
40 POINTS!!! NEED GOOD ANSWERS!!!
What is the correct definition of conflict? A. A disagreement between people with opposing viewpoints. B. A negative and unjustly formed opinion, usually against people of a different racial, religious, or cultural group. C. Using another person to help reach a solution that is acceptable to both sides. D. Discussing problems face-to-face in order to reach a solution.
The statement (A) is correct. A disagreement between people with opposing viewpoints.
What do you mean by conflicts?A conflict is a struggle and a clash of interest, opinion, or even principles. Conflict will always be found in society; as the basis of conflict may vary to be personal, racial, class, caste, political and international.
Moreover, conflict is serious disagreement and argument about something important. If two people or groups are in conflict, they have had a serious disagreement or argument and have not yet reached agreement. Try to keep any conflict between you and your ex-partner to a minimum.
Therefore, the opposing force created, the conflict within the story generally comes in four basic types: Conflict with the self, Conflict with others, Conflict with the environment and Conflict with the supernatural.
Learn more about conflicts:
https://brainly.com/question/12832202
#SPJ2
A group of environmental activists in West Virginia wants to save a large forest. Which act will help them in this activity?
1. Nature conservancy
2. Toxic substance control act
3. Eastern wilderness areas act
4. Endangered species act
Answer:
A
Explanation:
Answer: 1. Nature conservancy
Explanation:
Nature conservancy is the process or initiative taken by the human society to conserve the regions of forests and the associated wildlife, fossil fuels, water sources and others. This practice will ensure that the valuable resources will remain available for the present as well as for the future generation of human beings.
On the basis of the above description, nature conservancy is the activity which will help the environmental activists to save the forests.
Mid-ocean ridges are underwater mountainous regions formed by the separation of ___________. A) tsunamis B) tectonic plates C) continental divides D) subatomic particles
Answer:B, tectonic plates
Explanation:
Which process involves making glucose without energy from sunlight?
A. Photosynthesis
B. ATP formation
C. NADPH formation
D. Chemosynthesis
Answer:
Chemosynthesis
Explanation:
Its right trust me
the correct answer is chemosynthesis <3
Chapter8 lesson 2 cell structure
Answer:
Can you give me more details about this question?
Answer:
wdym
Explanation:
How does introduced species harm our planet?
Please someone answer this
ASAP!!!
Introduced species can harm our planet because in some regions of the world we are not prepared for their type of species, which can all in all cause damage.
Answer: alteration of the ecosystem
Explanation:when a new specie is introduced into the ecosystem it may have profound affects in the ecosystem and may also be called an invasive specie.
The affects that it may have on the ecosystem include
1.outcompeting the native specie and sometimes even leading to their extinction because the new specie may be modified in such a way as to have better chances of survival in the ecosystem because of their evolved genetics e.g : the new specie may encounter a native and non evolved specie of the ecosystem and compete with it for survival leading to reduction and even complete eradication of the native specie
Influenza, or the flu, is an infectious disease that affects mammals and birds. The flu cannot be treated with antibiotics because
A.
it is caused by two unique strains of bacteria.
B.
it is caused by a fungus, not a bacterium.
C.
it is caused by a virus, not a bacterium.
D.
it is caused by a highly resistant strain of bacteria.
Answer:
C. It is caused by a virus, not a bacterium
Explanation:
The answer is C influenza is caused by viruses not a bacterium
viruses invade your cells and the antibiotics can’t get to your cells through the blood they can only kill bacteria which harbours inside the blood
1: Fill in the blanks: The process of
_____is
the scientific term used for water moving across
a semi-permeable membrane. Water tends to
move from the side with a________
concentration of solute to the side of the
membrane with a________
concentration of
solute
In order: osmosis, higher, lower
Osmosis higher lower
Can a tornado pick up a person and send it to another island?
Answer: almost imposiable
Explanation: If you do happen to get picked up a tornado the longest time you will stay in it is approximately 5 minutes before it throws you out of it. If you did so happen to be swept in a tornado near a island it is possiable, but tornados over water die very very fast so this is very unlikley.
Hope this helps
Answer:
Nope.
Explanation:
Now I don't know anything about much about tornado's. But I'm pretty sure it won't pick up that person and send it to another island. I don't think the tornado have enough force to throw the person to another island. It will, however, send that person on another area maybe close to the tornado area. But yet again I don't the tornado have the abilty to do that.
A geologist concludes that a rock sample is an extrusive igneous rock. Based on this information, which statement about the rock is accurate?
A. The rock formed from cooling lava.
B. The rock likely came from a pluton.
C. The rock cooled slowly over millions of years.
D. The rock formed within Earth's crust.
The correct answer is D
The accurate statement about an extrusive igneous rock is that it formed from cooling lava, which cools quickly at the Earth's surface, leading to a finer-grained texture.
Based on the information that a geologist concludes a rock sample is an extrusive igneous rock, the accurate statement about the rock is A. The rock formed from cooling lava. Extrusive igneous rocks such as basalt are formed above the surface when molten rock, known as lava, extrudes onto the Earth's surface and cools quickly. This rapid cooling does not allow large crystals to form, leading to a finer-grained texture, and in some cases, such as with obsidian, a glassy texture due to the extremely rapid cooling.
Option B is incorrect because rocks that come from plutons are intrusive, rather than extrusive, and they cool slowly within the Earth's crust. Option C is incorrect as extrusive igneous rocks do not cool slowly over millions of years. Option D is also incorrect because extrusive igneous rocks form at the Earth's surface, not within the Earth's crust.
Solve this Sex-Linked traits practice problem