In 1943 the temperature in rapid city South Dakota fell about 45 degrees in 5 minutes what was the average drop in temperature per minute

Answers

Answer 1
9 degrees per minute

Answer 2

Answer:-9 degrees

Step-by-step explanation:The average drop in temperature per minute is 9 degrees.


Related Questions

17 ÷ 4520= what is the product

Answers

265 Remainder 15. That is, if you flip the divisor and the dividend around.

The student's question is related to dividing 17 by 4520. This is performed by a straight division resulting in a small decimal quotient, not a product. The calculation is best done using a calculator and rounding to the proper number of significant figures.

The equation given, 17 by 4520, is asking for the result of dividing 17 by 4520. To compute this, we simply perform the division, recognizing that since 4520 is much larger than 17, the answer will be a very small decimal value. The term 'product' in the student's question seems to be a mistake, as they are likely referring to the quotient obtained from the division.

When attempting to perform the computation mentally and simplify the process, one might attempt to find numbers that are more easily divisible or apply scientific notation to simplify calculations, much like re-expressing numbers to make them more manageable. However, for this division, no mental math trick simplifies it effectively, and using a calculator might be the best option.

When going through this process, it is also important to consider significant figures when giving the final answer, rounding as necessary based on the precision of the data provided.

factor the expression 10x−25y

Answers

5(2x-5y) is the answer to this expression

Final answer:

To factor the expression 10x-25y, we find the greatest common factor, which is 5, and write the expression as 5(2x - 5y).

Explanation:

To factor the expression 10x−25y, we need to find the greatest common factor (GCF) that both terms share. In this case, both terms are divisible by 5. When we factor out the GCF, we get:

Identify the GCF of 10x and 25y, which is 5.

Divide both terms by the GCF: 10x/5 = 2x and 25y/5 = 5y.

Write the factored expression: 5(2x - 5y).

Thus, the expression 10x−25y factored is 5(2x - 5y)

HELP!!! A pentagonal pyramid is sliced parallel to its base. what shape does it make?

Answers

pentagonal
same as the base

The cross section formed would also turn out to be a pentagon. 

Good luck! =D

a pail hold 6 3/4 gallon of water. how much is this in cups

Answers

there are 16 cups in 1 gallon so you would have to turn the denominator in the fraction into a 16 meaning you would multiply by 4 (because 4 goes into 16, 4 times). Your new fraction is 12/16. now you do 6 gallons*16 cups and you get 96 cups. Then you add the fraction onto 96 and you would be adding 12. Your final answer is 108 cups in 6 3/4 gallons

The required, there are 108 cups of water in the pail as a pail hold 6 3/4 gallon of water.

What is a unit of measurement?

Unit of measurement is defined as every entity having its measures in dimensions, weight, and time. Such as for length we have a meter, for liquid we have liters, and so on.

Here,
To convert 6 3/4 gallons to cups, we can use the fact that there are 16 cups in one gallon.

So, we can start by multiplying 6 (the number of whole gallons) by 16 to get the number of cups in those gallons:

6 gallons × 16 cups/gallon = 96 cups

Next, we need to convert the 3/4 of a gallon to cups. To do this, we can multiply the fraction by the number of cups in one gallon:

3/4 gallon × 16 cups/gallon = 12 cups

So, the total amount of water in the pail is:

96 cups + 12 cups = 108 cups

Therefore, there are 108 cups of water in the pail.

Learn more about unit conversion here:

https://brainly.com/question/5873219

#SPJ2

A person at ground level measures the angle of elevation to the top of a building to be 74 degrees. If at this point the person is 34 feet away from the base of the building, then how tall is the building? (Please round to the tenths place; please show work/steps and provide units with your answer) WILL GIVE BRAINIEST

Answers

to find the height of the building multiply the distance ( 34 feet) by the tangent of the angle(74)

34 * tan(74) = 118.57 feet


Hello,


34 * tan(74) = 118.57 feet


Hope this helps

The temperature, t, in Burrtown starts at 32°F at midnight, when h = 0. For the next few hours, the temperature drops 2 degrees every hour.Which equation represents the temperature, t, at hour h?

Answers

Answer: We find the equation that represents the temperature (t) at hour (t) using the slope-intercept form and it is:

t = -2 h + 32


Solution:

The temperature, t, in Burrtown starts at 32°F at midnight, when h = 0. This represents the y-interception of the right line, when h=0 hours, t=32 °F:

Point=(h,t)→Point=(0,32)=(0,b)→b=32

For the next few hours, the temperature drops 2 degrees every hour. This represents the slope of the line (m): m=-2, negative because the temperature drops.

Slope-Intercept form:

y=mx+b; y=t, m=-2, x=h, b=32

Replacing the values:

t=-2h+32


Answer:

t=-2h+32

Step-by-step explanation:

hich sentence is a run-on sentence?


A.
Dogs and hamsters are both fun pets, they relate to people in different ways.


B.
Dogs enjoy human contact; they love to fetch and chase.


C.
My hamster likes to run in his wheel, and he does not like to be held.


D.
When I try to pick up my hamster, he looks for a place to hide.

Answers

Hello!

This question has been asked under the weong subject, but I'll answer anyway.

The correct answer, I believe, would be: A. Dogs and hamsters are both fun pets, they relate to people in different ways.

I really hope this helped you out! :)

please help me, solve for y 2x-y=5

Answers

2x−y=5

Add -2x to both sides.

2x−y+−2x=5+−2x

−y=−2x+5

Divide both sides by -1.

[tex] \frac{-y}{-1} = \frac{-2x+5}{-1} [/tex]
‌y=2x−5

Answer:

y=2x−5

A bicycle went 120 miles in 5 hours. A motorcycle is three times as fast as the bicycle. Find the speed of motorcycle.

Answers

If the bicycle went 120 miles in 5 hours, and the motorcycle was three times as fast as the bicycle, then the motorcycle went 480 miles in 5 hours.

Answer:

Step-by-step explanation:

120 x 5 = 600

The motorcycle is 3 times as fast.

600 x 3 = 1800

suppose you deposit $25,000 in to a fund for which the annual interest rate is 5.3% compounded continuously. find the number of years it will take to double in value (round your answer to the nearest tenth of a year)

Answers

so, the principal is 25,000, when it double then, the accumulated amount is 50,000.

[tex]\bf \qquad \textit{Continuously Compounding Interest Earned Amount}\\\\ A=Pe^{rt}\qquad \begin{cases} A=\textit{accumulated amount}\to &\$50000\\ P=\textit{original amount deposited}\to& \$25000\\ r=rate\to 5.3\%\to \frac{5.3}{100}\to &0.053\\ t=years \end{cases} \\\\\\ 50000=25000e^{0.053t}\implies \cfrac{50000}{25000}=e^{0.053t}\implies 2=e^{0.053t} \\\\\\ ln(2)=ln(e^{0.053t})\implies ln(2)=0.053t\implies \cfrac{ln(2)}{0.053}=t \\\\\\ 13.0782486898102888\approx t\implies 13.08\approx t[/tex]

A relation is plotted as a linear function on the coordinate plane starting at point E at
(0, 27)
and ending at point F at
(5, −8).

What is the rate of change for the linear function and what is its initial value?

Answers

[tex]\bf \begin{array}{ccccccccc} &&x_1&&y_1&&x_2&&y_2\\ % (a,b) &&(~{{ 0}} &,&{{ 27}}~) % (c,d) &&(~{{ 5}} &,&{{ -8}}~) \end{array} \\\\\\ % slope = m \stackrel{\stackrel{average}{rate~of~change}}{slope}= {{ m}}\implies \cfrac{\stackrel{rise}{{{ y_2}}-{{ y_1}}}}{\stackrel{run}{{{ x_2}}-{{ x_1}}}}\implies \cfrac{-8-27}{5-0}\implies \cfrac{-35}{5}\implies -7[/tex]

well, when x = 0, namely at the very beginning, y = 27, thus, that IS the initial value.

The rate of change and the initial value are given as -5 and 27 respectively.

How to represent a straight line on a graph?

To represent a straight line on a graph consider two points namely x and y intercepts of the line. To find x-intercept put y = 0 and for y-intercept put x = 0. Then draw a line passing through these two points.

Given that,

The points for the given linear function are given as (0, 27) and (5, -8) respectively.

The rate of change is equivalent to the slope of the straight line and is given as,

(-8 - 27)/(5 - 0) = -35/7 = -5

Now, the equation of the function can be written as,

(y - 27)/(x - 0) = -5

=> y - 27 = -5x

=> y = -5x + 27

The initial value is given at x = 0 as below,

y = -5 × 0 + 27

  = 27

Hence, the rate of change for the function is -5 and its initial value is 27.

To know more about straight line equation click on,

brainly.com/question/21627259

#SPJ2

5 less than a third of a number is at most 15

Answers

1/3x - 5 < = 15 ...this is ur inequality

***
5 less....- 5
1/3 of a number....1/3x
so 5 less then 1/3 of a number....1/3x - 5
is at most 15....means it can be 15 or less.....< = 

Simply (8xto4) (4x to 3) \ 7x to 2

Answers

32x^5/7 This is the answer for that equation.

The Mississippi River is about 4,000 kilometers long. An M&M is about 1 centimeter long. There are 100 centimeters in a meter, and 1,000 meters in a kilometer. Estimate how many M&Ms it would take to measure the length of the Mississippi River

Answers

To be able to determine the number of M&Ms that are needed in order to measure the length of Mississippi River, we convert the units to a common one. For this purpose, we convert kilometers to centimeter such that,
 
Length of Mississippi River = (4000 km)(1000 m/1 km)(100 cm/1 m)
                       = 400,000,000 cm

Since there are 400,000,000 cm in the entire length of the river, the answer would also be 400,000,000. 

To measure the approximately 4,000 km long Mississippi River with M&Ms, we will need about 400,000,000 M&Ms, as there are 100 cm in a meter and 1,000 m in a km.

The question involves estimating the length of the Mississippi River using the size of M&Ms as a unit of measurement. Since the river is about 4,000 kilometers long and the standard unit of length in the SI system is the meter, we need to convert kilometers to centimeters to match the size of an M&M, which is about 1 centimeter long. There are 100 centimeters in a meter, and 1,000 meters in a kilometer. Therefore, we have:

Convert kilometers to meters: 4,000 km x 1,000 m/km = 4,000,000 m.Convert meters to centimeters: 4,000,000 m x 100 cm/m = 400,000,000 cm.

Now, since each M&M is 1 centimeter, the number of M&Ms needed to measure the length of the Mississippi River is equal to the total number of centimeters:

400,000,000 M&Ms would be required to measure the approximate length of the Mississippi River.

Find the equation of the ellipse with the following properties. The ellipse with x-intercepts (2, 0) and (-2, 0); y-intercepts (0, 4) and (0, -4).

Answers

check the picture below.

[tex]\bf \textit{ellipse, vertical major axis}\\\\ \cfrac{(x-{{ h}})^2}{{{ b}}^2}+\cfrac{(y-{{ k}})^2}{{{ a}}^2}=1 \qquad \begin{cases} center\ ({{ h}},{{ k}})\\ ------\\ h=0\\ k=0 \end{cases} \\\\\\ \cfrac{(x-0)^2}{2^2}+\cfrac{(y-0)^2}{4^2}=1\implies \cfrac{x^2}{4}+\cfrac{y^2}{16}=1[/tex]

solve each inequality. Justify each step (y-) - 4 + 2y > 11

Answers

It would stop at 3y+4>11 because the 3y and 4 are unlike terms and can only be divided or multiplied.

calculate the cost of fuel. 40 L at 65.7cents/L

Answers

26 dollars and 28 cents

$26.28 
Multiply 65.7 × 40 = 2,628 
Then add the decimal between 26 and 28

What expression is equivalent to x^2+2x-24/3x+18

Answers

The equivalent expression to [tex]x^2 + 2x - 24 / (3x + 18([/tex] is (x - 4) / 3, after factoring and simplifying the common terms.

The question is asking for an expression equivalent to [tex]x^2 + 2x - 24 / (3x + 18[/tex].

This expression can be factored and simplified.

First, notice that the quadratic expression in the numerator can be factored into (x + 6)(x - 4).

Similarly, the denominator can be factored as 3(x + 6). After factoring, we have:

= (x + 6)(x - 4) / 3(x + 6)

We can now simplify the expression by canceling out the common factor of (x + 6):

= (x + 6)(x - 4) / 3(x + 6) = (x - 4) / 3

So the equivalent expression is (x - 4) / 3.

Which expression shows the result of applying the distributive property to 3(2x−6) ?

A. 2x−18
B. 6x−18
C. 6x−6
D. 5x−3

Answers

Your answer would be B. You have to multiply the 3 and 2 which is 6 then put the x so 6x. then your multiply 3 and 6 and get 18 so it would be 6x-18.

Answer:

b

Step-by-step explanation:

A recipe makes 6 2/3 cups the serving size is 5/6 cup how many servings does the recipe make

Answers

ithe recipe makes precicely 8 servings,i hope this helps

The recipe can make serving 8 cups.

What is  multiplication?

In mathematics, multiplication is a method of finding the product of two or more numbers. It is one of the basic arithmetic operations, that we use in everyday life.

Here, given that,

A recipe makes 6 2/3 cups

                         =20/3 cups

And, the serving size is 5/6 cup

So, the recipe can make serving = 20/3÷ 5/6 cups

                                                      =20/3 × 6/5 cups

                                                      =8 cups

Hence, the recipe can make serving 8 cups.

To learn more on multiplication click:

brainly.com/question/5992872

#SPJ3

The sides of a triangle measure 76 mm, 8 CM, and 10 CM..What is the lengths of the two shorter sides

Answers

The two shorter sides are 76 mm and 8 cm(80 mm)

What is cos θ if sec θ = 2?

Answers

[tex]\bf cos(\theta)=\cfrac{1}{sec(\theta)}\qquad \qquad \boxed{sec(\theta )=2}\implies cos(\theta)=\cfrac{1}{\boxed{2}}[/tex]

Answer:

the value of cos θ is [tex]\frac{1}{2}[/tex].

Step-by-step explanation:

Since, [tex] cos\theta=\frac{1}{sec\theta}[/tex]

we are given with sec θ = 2

To find the value of cos θ , we use this fact [tex] cos\theta=\frac{1}{sec\theta}[/tex]

put sec θ = 2 in [tex] cos\theta=\frac{1}{sec\theta}[/tex]

[tex] cos\theta=\frac{1}{2}[/tex]

Therefore, the value of cos θ is [tex]\frac{1}{2}[/tex].

The length of a rectangle is one unit shorter than one-sixth of the width, x. Which expression represents the perimeter of the rectangle? 7/3x−2 1/3x−4 1/3x−2 ​ 7/3x−8

Answers

Width: x
Length: 1/6x-1
Perimeter
=x+x+1/6x+1/6x-1-1
=14/6x-2
=7/3x-2

Answer: [tex]\dfrac{7}{3}x-2[/tex]

Step-by-step explanation:

Let x be the width of the rectangle , then the length of the rectangle will be :_

Length = [tex]\dfrac{1}{6}x-1[/tex]

We know that the perimeter of a rectangle is given by :-

[tex]P=2(l+w)[/tex]

Substitute the value of length and width we get,

[tex]P=2(\dfrac{1}{6}x-1+x)[/tex]

Combine like terms, we get

[tex]P=2(\dfrac{1+6}{6}x-1)\\\\\Rightarrow\ P=2(\dfrac{7}{6}x-1)\\\\\Rightarrow\ P=2\times\dfrac{7}{6}x-2\times1\\\\\Rightarrow\ P=\dfrac{7}{3}x-2[/tex]

Hence, the expression represents the perimeter of the rectangle : [tex]\dfrac{7}{3}x-2[/tex]

He for got his pin code. 20% of his pin code was 246.8. What was his pin code?

Answers

So if 20% of his pin code was 246.8, then we want to know 5 times that since 20% * 5 = 100%.

So 246.8 * 5 = 1234

So his pin was 1234.

the slope of the line that passes through the points (-6,w) and (-10,4) is 1/8. what is the value of w

Answers

Use the point-slope formula for the eqn of a str line:

y-k = m(x-h), where (h,k) is any point on the line.

Suppose we first focus on the given point (-10,4).  Let (h,k) = (-10,4).

Then  y-k = m(x-h) becomes    y-4 = m(x-[-10])

The other point is (-6,w), where w is the unknown we must determine.

w-4 = (1/8)(-6+10).  Find w:
 
Mult both sides by 8 to remove the fraction 1/8:

8w-32 = -6 + 10 = 4.  Then 8w = 32+4 = 36.  w = 36/8 = 4.5, or 9/2 (ans.)

 

The value of 'w' using the given slope is [tex]\frac{9}{2}[/tex]

Given :

the slope of the line that passes through the points (-6,w) and (-10,4) is 1/8

apply slope formula

[tex]slope =\frac{y_2-y_1}{x_2-x_1}[/tex]

Substitute the values given in the points and make it equal to 1/8

[tex]slope =\frac{4-w}{-10+6}=\frac{1}{8} \\\frac{4-w}{-4}=\frac{1}{8}\\(4-w)(8)=-4(1)\\32-8w=-4\\-8w=-4-32\\-8=-36[/tex]

Divide both sides by -8

[tex]w=\frac{-36}{-8} =\frac{9}{2}[/tex]

The value of 'w' is [tex]\frac{9}{2}[/tex]

Learn more : brainly.com/question/19616909

An m-bit password is required to access a system. a hacker systematically works through all possible m-bit patterns. let x be the number of patterns tested until the correct password is found. find the conditional pmf of x given that the password has not been found after k tries

Answers

Final answer:

The conditional pmf of x, the number of patterns tested until the correct m-bit password is found, given that the password has not been found after k tries, is uniformly distributed with 1/(2^m - k) for x = k+1, k+2, ..., 2^m.

Explanation:

The question deals with the topic of probability and specifically centers around the concept of a conditional probability mass function (pmf). Given that an m-bit password is systematically being guessed by a hacker and has not been found after k attempts, we need to find the conditional pmf of x, where x is the number of patterns tested until the password is found.

Since the password has not been guessed within the first k tries, the conditional probability is based on the remaining 2m - k possibilities. The distribution of x will be uniform because each subsequent attempt has an equal probability of being correct. The conditional pmf of x given that the password was not found after k tries is 1/(2m - k) for x = k+1, k+2, ..., 2m.

For a normal distribution, the proportion in the tail beyond z = 0.30 is p = 0.1179.
a. True
b. False

Answers

they tricked me into signing into this site to get the answer, oonly to find out they didnt have it answered, click b8

Using the normal distribution, it is found that the statement is False, thus the correct option is b.

In a normal distribution with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex], the z-score of a measure X is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

It measures how many standard deviations the measure is from the mean. After finding the Z-score, we look at the z-score table and find the p-value associated with this z-score, which is the percentile of X.The area on the tail beyond z is the proportion that is above z, that is, 1 subtracted by the p-value of z.

For this problem, z = 0.3 has a p-value of 0.6554.

1 - 0.6554 = 0.3446

The proportion in the tail beyond z = 0.30 is p = 0.3446, thus, the statement is False.

A similar problem is given at https://brainly.com/question/12518252

A bus can carry 50 people per run. At least how many times does the bus have to run in order to transfer 25,000 people?

Answers

500 times, to transfer 25,000 people. Let me know if this helped.
500 times is the answer

If you are adding two fractions that are both less than 1/2, What must be true about the sum? Give three examples to support your thinking.

Answers

if both fractions are less than  1/2 then the sum has to be less than 1

1/8 + 3/8 = 4/8 = 1/2 , less than 1

7/16 + 1/4 = 11/16, less than 1

3/16 + 1/16 = 4/16 = 1/4, less than 1

First assume that the fractions are all positive.
Next, add 1/2 and 1/2; the sum is 1.  Thus, the two fractions must each be smaller than 1/2.

Let's try adding 5/16 and 7/16.  Both are smaller than 1/2.  Their sum is 12/16, or 3/4, which is less than 1.

Choose a couple other pairs of fractions which are between 0 and 1/2.  Then find the sum of each pair.  What do you observe about the size of these sums?

Can anyone help me Plot a parabola through the points? Cause i dont understand what to do

Answers

There are youtube videos on how to this operation. :)
Since the vertex is (0,0), and the parabola passes through -1 and +1, then it opens upward with a minimum of (0,0).

Join the Vetex to -1 and + 1 It will have the shape of U

Other Questions
Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer What is the basic structural unit of both dna and rna? How would you write the sentence "you [formal] need to study for english class" and "you [informal] need to study for english class" in spanish? Choose the correct relative pronoun for the sentence:A blender is a kitchen appliance ____ can finely chop food and even make smoothies.A) that B) who C) whom D) whose Complete the following sentences using the correct forms of the verb nacer or vivir or the phrases describing time or family relationships that you have learned so far. Fill in the blanks: a. Andrea es la __________ de Fabin. Ellos piensan casarse pronto. b. Abuelo Agustn es el ____________ de Samuel. Samuel es su hijo. c. Marisol ____________ en Veracruz. Luego vivi por un tiempo ah. Luego se mud. d. Fabin ____________ viva en Monterrey. ____________ vive en Puebla. e. Samuel es el ____________ de Marisol. Estn casados desde hace mucho tiempo. Pedro y Andrea son sus ____________. f. La abuela Mercedes ____________ en Puebla. El mes pasado viva en Guadalajara. Ella es la ____________ de Samuel. g. Andrea y Pedro son ____________ y tambin son nietos de Mercedes y Agustn. h. Fabin y Andrea son ____________. Pronto van a ser esposos. i. Abuelo Agustn ____________ en Cancn y vivi un tiempo all. How many triangles exist with 80 degrees, 50 degrees, and 50 degrees? Object relations theorists believe the infant's need for ______________ influences the development of the self. Sequence 13, 39, 65, 91, Which of the following plant adaptations protects savanna plants from grazers?a.long rootsb.growing low to the groundc.water storaged.bitter tasteTHE ANSWER IS: bitter taste How did Paleolithic people benefit from living together in a group? HELP ASSAPP WITH THIS QUESTION Following Jays Treaty, George Washingtons approval rating, to borrow a modern phrase, plummeted and there was even talk in the House of impeaching him. Why was this treaty so offensive to some? Anti-semitism in russia in the late 1800s was a "push" factor that caused many people to leave their home country and migrate to the US.True or False factor the polynomial completely using x method x2+16x+48 Evaporation is ________. check all that apply. check all that apply. an endothermic process sometimes a warming process always a cooling process sometimes a cooling process an exothermic process always a warming process Why is it important that melanin is present in its highest concentration in the keratinocytes at or near the basale layer of cells? What conclusion can you draw from the fact that Spanish and Portuguese are the most commonly spoken languages in Latin America? A)Latin Americans have chosen to speak Romance languages. B)Latin Americans were born in Spain and Portugal and then moved. C)Spain and Portugal colonized Latin American nations during the 15th and 16th centuries. D)Many Latin Americans travel to Spain and Portugal and learn the language while visiting.