Find the inverse laplace transform of the function by using the convolution theorem. f(s) = 1 s5(s2 + 1)

Answers

Answer 1
By the convolution theorem,

[tex]f(t)=(g*h)(t)=\displaystyle\int_{\tau=0}^{\tau=t}g(\tau)h(t-\tau)\,\mathrm d\tau\implies F(s)=G(s)H(s)[/tex]

where [tex]F(s),G(s),H(s)[/tex] are the respective Laplace transforms of [tex]f(t),g(t),h(t)[/tex].

We have

[tex]F(s)=\dfrac1{s^5(s^2+1)}=\dfrac1{4!}\dfrac{4!}{s^5}\times\dfrac1{s^2+1}[/tex]

If we let [tex]G(s)=\dfrac{4!}{s^5}[/tex] and [tex]H(s)=\dfrac1{s^2+1}[/tex], then clearly [tex]g(t)=t^4[/tex] and [tex]h(t)=\sin t[/tex], so by the convolution theorem,

[tex]f(t)=\dfrac1{4!}t^4*\sin t=\displaystyle\frac1{24}\int_{\tau=0}^{\tau=t}\tau^4\sin(t-\tau)\,\mathrm d\tau=\frac{t^4}{24}-\frac{t^2}2+1-\cos t[/tex]

Related Questions

Simplify. 1/4 (-12+4/3)

Answers

Add what's in the parentheses first:  -12 + 4/3 = -10 2/3

Then multiply -10 2/3 by 1/4:  1/4 x -10 2/3 = - 2 2/3

So your answer is -2 2/3.

Hope this helps! :D

~PutarPotato
Final answer:

The simplification of 1/4 (-12+4/3) first involves simplifying the operation in the parentheses which gives -10.67. Multiplying this by 1/4 we get -2.67.

Explanation:

To simplify the expression 1/4 (-12+4/3), first simplify the operation in the parentheses.

-12 + 4/3 equals -12 + 1.33 (approx.), which simplifies to -10.67.

Then, multiply this result by 1/4. So, 1/4 of -10.67 equals -2.67 (approx.).

So, 1/4 (-12+4/3) simplifies to -2.67.

Learn more about Mathematical Simplification here:

https://brainly.com/question/33857870

#SPJ2

Julian is 10 years younger the Thomas. The sum of their ages is 74. What is Thomas’s age?

Answers

Thomas = x

Julian = x-10

x +x-10 = 74

2x-10 = 74

2x = 84

x = 84/2 = 42

Thomas is 42

Julian is 32


A family has five children. the probability of having a girl is 1/2. what is the probability of having at least 4 girls?

Answers

The probability of having at least 4 girls is 0.1875.

What is the cytoplasm? A. a fluid in which organelles are suspended B. a type of organelle that assembles proteins C. the exterior envelope surrounding the nucleus D. the inner surface of the cell's wall

Answers

Cytoplasm is A, a fluid in which organelles are suspended.

In 34 pound of a spice mix, there is 5/6 cup of cinnamon. How much cinnamon does the spice mix contain per pound? a 5/8 cup b ​ 9/10 ​ cup c ​ 1 1/9 ​ cups d ​ 1 3/5 ​ cups

Answers

Answer:

c. 1 1/9 cups

Step-by-step explanation:

To find cups per pound, divide cups by pounds.

  (5/6 cup)/(3/4 pound) = (5/6)/(3/4) cup/pound

  = (5/6)×(4/3) cup/pound . . . . . . . invert the denominator and multiply

  = 20/18 cup/pound = 10/9 cup/pound = 1 1/9 cup/pound

In the game of blackjack played with one​ deck, a player is initially dealt 2 different cards from the 52 different cards in the deck. a winning​ "blackjack" hand is won by getting 1 of the 4 aces and 1 of 16 other cards worth 10 points. the two cards can be in any order. find the probability of being dealt a blackjack hand. what approximate percentage of hands are winning blackjack​ hands?

Answers

We are given here that a blackjack hand consists of:

1 of the 4 aces = 4 / 52

1 of the 16 cards worth 10 points (10, jack, queen, king) = 16 / 52

 

So assuming that cards are dealt without replacement, therefore the probability of getting a blackjack hand is:

P = 1st is ace * 2nd is 10 pt card + 1st is 10 pt card * 2nd is ace

P = (4 / 52) * (16 / 51) + (16 / 52) * (4 / 51)

P = 0.04827 = 4.83%

 

Therefore there is a 4.83% probability to get a blackjack hand.

 

Final answer:

The probability of being dealt a blackjack hand with a single deck is approximately 0.0483, which translates to about 4.83% of the hands.

Explanation:

To find the probability of being dealt a blackjack hand in a single-deck game, we need to calculate the chances of drawing an ace and a 10-point card (10, Jack, Queen, or King) in any order. There are 4 aces and 16 cards worth 10 points in a deck of 52 cards. The probability of drawing an ace first is 4/52, and then drawing a 10-point card is 16/51, giving us (4/52)*(16/51). Conversely, if a 10-point card is drawn first (16/52) followed by an ace (4/51), the probability is (16/52)*(4/51). Adding the two probabilities gives us the chance of a blackjack in either order:

P(Blackjack) = (4/52)*(16/51) + (16/52)*(4/51) = (64/2652) + (64/2652) = 128/2652 ≈ 0.0483

The approximate percentage of hands that are winning blackjack hands is about 4.83%.

The department store where you work is having a sale. Every item is to be marked down 15% What will the sale price of a $152 coat be

Answers

multiply 152 by 15%

152 * 0.15 = 22.80 ( amount of discount

152 - 22.80 = 129.20 ( sale price)

Doors for a small cabinets are 11.5 inches long. Doors for the large cabinets are 2.3 times as long as the doors for the small cabinets. How many large doors can be cut from a board that is 10.5 feet long?

Answers

Hello!

1 ft = 12 inches.
10.5 ft = 126 inches.
11.5 × 2.3 = 26.45
126/26.45 = 4.76 (About)

4.76 large doors can be cut from a 10.5 ft long board.

The rectangular sandbox at the local community park has a width of 24.5 meters and its length is 31.7 meters. What is the perimeter, in meters, of the rectangular sandbox?

Answers

Final answer:

To calculate the perimeter of the rectangular sandbox, use the formula P = 2l + 2w, where l is the length and w is the width. For the given dimensions, 31.7 meters in length and 24.5 meters in width, the perimeter is 112.4 meters.

Explanation:

The question asks us to calculate the perimeter of a rectangular sandbox. The formula to calculate the perimeter of a rectangle is 2 times the length plus 2 times the width, often written as P = 2l + 2w.

Given the dimensions of the sandbox, the length (l) is 31.7 meters, and the width (w) is 24.5 meters.

We calculate the perimeter as follows:

Perimeter = 2 × Length + 2 × WidthPerimeter = 2 × 31.7 m + 2 × 24.5 mPerimeter = 63.4 m + 49.0 mPerimeter = 112.4 meters

Therefore, the perimeter of the rectangular sandbox is 112.4 meters.

solve the system of linear equations. separate the x- and y- with a coma.
6x=-14-8y
-12x=20+8y

Answers

Solve the following system:
{6 x = -8 y - 14 | (equation 1)
{-12 x = 8 y + 20 | (equation 2)
Express the system in standard form:
{6 x + 8 y = -14 | (equation 1)
{-(12 x) - 8 y = 20 | (equation 2)
Swap equation 1 with equation 2:
{-(12 x) - 8 y = 20 | (equation 1)
{6 x + 8 y = -14 | (equation 2)
Add 1/2 × (equation 1) to equation 2:
{-(12 x) - 8 y = 20 | (equation 1)
{0 x+4 y = -4 | (equation 2)
Divide equation 1 by 4:
{-(3 x) - 2 y = 5 | (equation 1)
{0 x+4 y = -4 | (equation 2)
Divide equation 2 by 4:
{-(3 x) - 2 y = 5 | (equation 1)
{0 x+y = -1 | (equation 2)
Add 2 × (equation 2) to equation 1:
{-(3 x)+0 y = 3 | (equation 1)
{0 x+y = -1 | (equation 2)
Divide equation 1 by -3:
{x+0 y = -1 | (equation 1)
{0 x+y = -1 | (equation 2)
Collect results:
Answer:  {x = -1
         {y = -1

Please note the parentheses should span over both equations but the editor doesn't allow that. see example.

Answer:

-16         81       19

Step-by-step explanation:

Round 10,386.145 to the nearest tenth

Answers

Rounded to the nearest tenth would be one since the four isn't higher. So the answer would be 10,386.1. You did mean the tenths place right?? because could have also meant tenth(8)

What is the matter with this number: .000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001
Is it real?

Answers

possibly. its prob like 1trillion
yes, it is just a really really small fraction of 1

20 randomly selected statistics students were given 15 multiple-choice questions and 15 open-ended questions - all on the same material. the professor was interested in determining which type of questions the students scored higher. this experiment is an example of a one sample test of means. a two sample test of means. a paired t-test. a test of proportions.

Answers

I think that this an example of a paired t test. Since each student (subject) is given 2 treatments of the same material. 

Karen is riding her bike at 4 miles per hour she wants to show this on a graph what should she draw

Answers

Graph needs to be labeled. I labeled it as shown on picture. It also needs a title. The title can be up to you. :) you can title it “Karen riding her bike”

a recipe makes a total of 5 cups a serving of pudding is 3/4 cup how many servings of pudding does the recipe make?

Answers

Final answer:

To find the number of servings of pudding the recipe makes, divide the total number of cups by the serving size. The recipe makes approximately 6.67 servings of pudding.

Explanation:

To find the number of servings of pudding the recipe makes, divide the total number of cups by the serving size. In this case, the recipe makes 5 cups and each serving is 3/4 cup. So, to find the number of servings, divide 5 cups by 3/4 cup: 5 cups ÷ (3/4 cup) = 5 cups × (4/3 cup) = 20/3 servings

Therefore, the recipe makes approximately 6.67 servings of pudding.

a garden table and a bench cost $1,000 combined the cost of a garden table is three times the cost of the bench what is the cost of the bench.

Answers

it shold be something like 834 or something liek that

Every week, Mr. Kirkson uses 316 gallon of water to water every 13 square foot of his garden. How many gallons of water does Mr. Kirkson use per square foot to water his garden each week? Enter your answer in the box as a fraction in simplest form.

Answers

square foot = f
316/13=f.
f = 24 4/13

Is It A Fraction If So Then The Answer Is [tex]\frac{9}{16}[/tex]


If Not Then The Other Guy Is Right







              HoPe It HeLpS PlEaSe MaRk Me ThE BRAINlYEST!!!!!!!!!!!!

A wheel turns 1,800 revolutions per minute. How fast does it turn in radians per second?

Answers

1800:60=30 revolutions per second
30*2π=60π radians per second

A wheel turn 60π radians per second.

What is Division method?

Division method is used to distributing a group of things into equal parts. Division is just opposite of multiplications. For example, dividing 20 by 2 means splitting 20 into 2 equal groups of 10.

Given that;

A wheel turns 1,800 revolutions per minute.

Now,

Since, A wheel turns 1,800 revolutions per minute.

Hence, Number of revolution in one seconds = 1800 / 60

                                                                       = 30

We know that;

⇒ 1 revolution = 2π radian

So, Number of revolution in radian per second = 30 × 2π

                                                                         = 60π

Learn more about the divide visit:

https://brainly.com/question/28119824

#SPJ2

A solid lies above the cone z = x2 + y2 and below the sphere x2 + y2 + z2 = z. write a description of the solid in terms of inequalities involving spherical coordinates

Answers

Final answer:

The solid lying above the cone z = x^2 + y^2 and below the sphere x^2 + y^2 + z^2 = z, in spherical coordinates, is described by the inequalities 0 ≤ ρ ≤ 2 cos φ (W.r.t the sphere) and φ ≥ π/4 (W.r.t the cone), with 0 ≤ θ ≤ 2π (full revolution for θ).

Explanation:

In spherical coordinates, we represent a point in space using three values: ρ (the distance from the origin), φ (the angle measured from the positive z-axis down to the line connecting the origin and the point), and θ (the angle measured in the x-y plane from the positive x-axis to the projection of the line segment from the origin to the point).

The given cone z = x2 + y2 in spherical coordinates becomes ρ cos φ = ρ2 sin2 φ, which simplifies to tan φ = 1/ρ or φ = π/4. This is because for a cone with vertex at the origin, φ is constant. So, our first inequality is φ ≥ π/4.

The sphere's equation x2 + y2 + z2 = z becomes ρ2 = ρ cos φ, which further simplifies to ρ = 2 cos φ. So, the second inequality is ρ ≤ 2 cos φ, which bounds ρ from above by the sphere.

In summary, the solid is described by the inequalities 0 ≤ ρ ≤ 2 cos φ and φ ≥ π/4, with 0 ≤ θ ≤ 2π (since θ revolves full circle in spherical coordinates).

Learn more about spherical coordinates here:

https://brainly.com/question/31745830

#SPJ12

Final answer:

The solid can be described using the inequalities: 0 ≤ r ≤ cos(θ), 0 ≤ θ ≤ 2π, and 0 ≤ ϕ ≤ π. These inequalities define the limits for the radius, polar angle, and azimuthal angle in spherical coordinates.

Explanation:

To describe the solid in terms of inequalities involving spherical coordinates, we need to find the limits for the radius, polar angle, and azimuthal angle.

Considering the given information, the solid lies above the cone z = x2 + y2, which implies that the z-coordinate ranges from 0 to r2.

As for the sphere x2 + y2 + z2 = z, we can rewrite it in spherical coordinates as r2 = r cos(θ) or r = cos(θ).

Therefore, the solid can be described using the following inequalities in spherical coordinates:

0 ≤ r ≤ cos(θ) 0 ≤ θ ≤ 2π 0 ≤ ϕ ≤ π

Learn more about Solid described in spherical coordinates here:

https://brainly.com/question/31850328

#SPJ11

Jack has 702 acres of land which requires 1.2 acre-feet of water to grow crops successfully. Currently it cost 12.95 per acre-foot to purchase water. How much will it cost to water all his crops

A) 9,090.90
B) 10,909.08
C) 15,540.00
D) none

Answers

First, how much water is required?

Multiply 702 by 1.2 acre ft; the result is 842.2 acre ft of water.

Next, mult. this result by the rate $12.95/acre-ft:

$10909 to water his 702 acres of crops.

A person standing 20 feet from a street light casts a 10 foot shadow. How many times taller is the streetlight than the person? Assume the triangles are similar.

Answers

check the picture below.

they're at a 3:1 ratio, thus, 3 times.

What are the coordinates of the vertex for f(x) = x2 + 4x + 10?

Answers

(-2,6) this is the coordinates of the vertex

Answer:

The coordinates of the vertex are [tex] (-2, -6)[/tex]

Step-by-step explanation:

The graph of this function is a parabola that opens up in the Cartesian plane. We can find like this:

[tex]y = (x ^ 2 + 4x +4) +6 = (x + 2) ^ 2 +6[/tex], where,  [tex](y - 6) = (x + 2) ^ 2[/tex]

In the canonical equation of the parabola:

[tex](y - k) = (x + h) ^ 2[/tex], with the point (h, k) as the vertex, [tex]h = -2[/tex] and [tex]k = 6[/tex].

Conclusion: the coordinates of the vertex are [tex](-2, -6)[/tex]

If 5x=3x-8, evaluate 4x+2

Answers

The answer is -14.
Hope it helps
5x=3x-8
2x = -8
  x = -4

4x+2
= 4(-4) +2
= -16 + 2
= -14

A heap of rubbish in the shape of a cube is being compacted into a smaller cube. given that the volume decreases at a rate of 4 cubic meters per minute, find the rate of change of an edge, in meters per minute, of the cube when the volume is exactly 125 cubic meters.

Answers

Working Formula:

V = s^3

Given:

dV/dt = -4 cubic meters per minute
V = 125 cubic meters

Required: ds/dt (rate of change of edge per minute)  at V = 125 m^3

Solution:

Differentiate, equation below 
V = s^3
dV/dt = 3*s^2 (ds/dt)
-4 = 3*s^2 (ds/dt)       
ds/dt = -1.33/s^2  -----------> eq. (1)

V = s^3
(125)^0.33 = (s^3)^0.33
s = 5                   ------------> eq. (2)

Substitute eq. (2) to eq. (1), we get

ds/dt = -1.33/(5)^2 = -0.053 meters per minute

ANSWER: -0.053 meters per minute





Using implicit differentiation, it is found that the rate of change of an edge is of -0.0533 meters per minute.

---------------------

The volume of a cube of edge e is given by:

[tex]V = e^3[/tex]

In this problem, the volume is of 125 m³, thus, we solve the above equation to find the length of an edge, in metres.

[tex]V = e^3[/tex]

[tex]125 = e^3[/tex]

[tex]e = \sqrt[3]{125}[/tex]

[tex]e = 5[/tex]

Now, for the rate of change, we need to apply the implicit differentiation, thus:

[tex]V = e^3[/tex]

[tex]\frac{dV}{dt} = 3e^2\frac{de}{dt}[/tex]

[tex]\frac{dV}{dt} = 3(5)^2\frac{de}{dt}[/tex]

[tex]\frac{dV}{dt} = 75\frac{de}{dt}[/tex]

Volume decreases at a rate of 4 cubic meters per minute, thus:

[tex]\frac{dV}{dt} = -4[/tex]

The rate of change of an edge is [tex]\frac{de}{dt}[/tex]. Then:

[tex]-4 = 75\frac{de}{dt}[/tex]

[tex]\frac{de}{dt} = -\frac{4}{75}[/tex]

[tex]\frac{de}{dt} = -0.0533[/tex]

The rate of change is of -0.0533 cubic meters per minute.

A similar problem is given at https://brainly.com/question/24158553

What is the solution of the equation f(x) = g(x) ?

A. x = -4
B. x = -2
C. x = 2
D. x = 4

Answers

We are given the two functions [tex]f(x) = x^{-\frac{1}{2} }[/tex] and [tex]g(x) = \sqrt{x} - \frac{3}{2} [/tex]. Since the question is asking us for the value of x when f(x) is equal to g(x), all we need to do is equate the respective expressions together. This is what the result should be:
[tex]x^{-\frac{1}{2}} = \sqrt{x} - \frac{3}{2}[/tex]
Now, just solve for x. If you want to save some time, you can use logic and then algebra. To do this, look at the square root. We cannot have an imaginary number, so we can rule out the first two options. Now, we are left with x = 2 and x = 4. When we plug in each x-value to the equation, only 4 works out with a result of 0.5 = 0.5. Therefore, the solution to f(x) = g(x) is D) x = 4. Hope this helps and have a great day!

Can someone help me with this?

Answers

check the picture below.

notice, the figure is really just a triangle on top of a semi-circle.

now, the triangle has a base and height of 3 each, and the semi-circle has a diameter of 3√(2), so its radius is half that.

[tex]\bf \begin{array}{llll} \textit{area of a circle}\\\\ A=\pi r^2 \end{array}\qquad \begin{array}{llll} \textit{area of a semi-circle}\\\\ A=\cfrac{\pi r^2}{2} \end{array}\qquad \begin{array}{llll} \textit{area of a triangle}\\\\ A=\cfrac{1}{2}bh \end{array}\\\\ -------------------------------\\\\[/tex]

[tex]\bf d=3\sqrt{2}\qquad r=\cfrac{3\sqrt{2}}{2}\impliedby \textit{radius of the semi-circle}\\\\ -------------------------------\\\\ \stackrel{\textit{area of triangle}}{\cfrac{3\cdot 3}{2}}+\stackrel{\textit{area of semi-circle}}{\cfrac{\pi \left( \frac{3\sqrt{2}}{2} \right)^2}{2}}\implies \cfrac{9}{2}+\cfrac{\frac{\pi \cdot 3^2\cdot 2}{2}}{2}\implies \cfrac{9}{2}+\cfrac{9\pi }{2} \\\\\\ \cfrac{9+9\pi }{2}[/tex]

What is the gcf for 84

Answers

84

84 = 42 x 2

The greatest common factor is 42, because 84/2 = 42, & you want the biggest number possible

Usually i need two or more numbers so.. this is the best i can get out of one number

hope this helps tho :D

What is 2 3/4 - 1/2? A. -2 1/4 B. 1 1/4 C. 2 1/4 D. 3

Answers

          2 3/4        2 3/4
     -       1/2      -    2/4
---------------     ---------
                         2 1/4

2 3/4 - 1/2 = 2 1/4

Suppose Georgette buys 400 shares of Google at $250 a share. She sells them at $350 a share. What is her capital gain?


a. 400 times $100



b. 400 times $250



c. 400 times $350



d. 400 times $600

Answers

That would be A. Hope this helped. ;)

Answer: A

Step-by-step explanation:

Isaac drinks 8 glasses of water each day. He says he will drink 2,920 glasses of water in a year that has 365 days. Is the exact answer reasonable

Answers

multiply 365 by 8

365 * 8 = 2920

so yes it is reasonable

2,920”divided”by 8 = 365so yes
Other Questions
John Adams Alien and Sedition Acts influenced the election of 1800 because can someone plz help me. Which of the following best describes the Battle of Britain? A. The bombardment of northern France to prepare for a British invasion of continental Europe B. The German sea landing on the southern coast of Britain C. An air battle above the English Channel to prepare for an invasion of Britain D. The sea battle between German U-boats and British battleships Why did the united states get involved in the korean war? what was the outcome of the war? By establishing this link between the levels of cooperation observed in _____ with local forest conditions, rustagi et al. have increased the confidence that scholars can have in the external validity of results from previous experiments carried out all over the world, with student and nonstudent subjects. Refer to landing service. because the company is known for its ability to produce lawn furniture more efficiently than any other company in the world, the company must have a(n) ____ advantage. If the mass of an object increases, the force acting on it, such as gravitational force, also increases. A manufacturer wants to implement a trade sales promotion. Which of the following would apply?A. Offering retail stores a 10% discount on their productsB. Offering mail-in rebates to consumers who purchase their productsC. Distributing coupons through newspapers for "buy one get one free" offers on their productsD. Purchasing television ads that promote the enhanced style of their products why did the catholic church feel threatened by the heliocentric theory of the universe A subway ride for a student costs $1.25. A monthly pass costs $35.Write an inequality that represents the number of times, x , you must ride the subway for the monthly pass to be a better deal. 10 lb____64 oz (equal to, greater than, less than) What is the primary mode of transportation for Manaus 1.9r+0.1r=0.6 what s the value of r which branch interprets laws and punishes lawbreakersA Legislative B ExecutiveC Judicial James and his friends both started a part-time job at the swimming hole earning $8 per hour . James worked 10/1-2 hours his first week James agreed to pay his friend 1/10 of his salary for reimbursement of gas. How many money did James pay his friend for gas ((WILL MARK BRAINLIEST))what is the equation of this graphed line (in slope intercept form)thank you! Explain how an action can be sinful , even if a person does not know that it is sinful. What is expanded form for 50,631 The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci? The function f(x)= -6x+11 has a range given by {-37,-25,-13,-1}.Select the domain values of the function from the list 1,2,3,4,5,6,7,8. explain how you arrived at your answer Steam Workshop Downloader