An ionic bond is formed when _____. See Concept 2.3 (Page 37) An ionic bond is formed when _____. See Concept 2.3 (Page 37) both atoms are equally attractive to electrons one atom transfers an electron to another atom both atoms are electrically neutral atoms are subjected to radioactive isotopes both atoms are nonpolar

Answers

Answer 1

Answer: The ionic bond is when one atom transfers an electron to another atom

Explanation:

Ionic bond is formed between oppositely charged substances - a positively charged substance, and a negatively charged substance.

Usually, an atom donates its electron (become positively charged) to another atom to complete its outermost shell (becoming negatively charged).

Thus, the formation of transfer of electrons creates an IONIC BOND


Related Questions

Assembling a complete sequence from fragment sequences
In the last step of shotgun sequencing, a computer analyzes a large number of fragment sequences to determine the DNA sequence of a whole chromosome. Given the following fragment sequences, what is the overall DNA sequence?
Enter the complete DNA sequence, which should contain 24 bases.

Answers

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

Sotonic saline and 5% dextrose in water are solutions that are considered Isotonic to human blood. What effect on red blood cells would you expect if a patient were given these fluids in an IV? A solution of 10% dextrose in water is hypertonic to blood. What would happen if you were to infuse your pationt with this solution?

Answers

Answer/Explanation:

1. Isotonic solutions are those with the same concentration of solute as another - in this case of human blood cells. The two solutions are said to have the same osmotic pressure, meaning they are in an equilibrium, and nothing will happen to the red blood cells.

2. In contrast, hypertonic solutions have more solute and less water than another solution, in this case the cytoplasm of the blood cells. I.e. the solution is more concentrated than the human blood cells. Therefore, water will flow out of the cell by osmosis to try to reach an equilibrium. This means that the red blood cell will shrink and shrivel up, as water leaves the cell in to the surrounding environment

Final answer:

Isotonic solutions like saline or 5% dextrose maintain the normal shape of RBCs by creating an osmotic equilibrium. Hypertonic solutions, like 10% dextrose, have a higher solute concentration than blood, causing water to leave RBCs, potentially leading to cell shrinkage and damage.

Explanation:

When a patient is given an isotonic saline solution or a 5% dextrose solution, it matches the solute concentration of human blood. As such, the red blood cells (RBCs) maintain their normal shape because water flows equally in and out of the cells, creating a state known as osmotic equilibrium.

However, a 10% dextrose solution is hypertonic, meaning it has a higher solute concentration compared to human blood. When a patient is given a hypertonic solution, water will leave the red blood cells to try to equalize the solute concentration. This can cause the cells to shrink or crenate, potentially leading to cell damage. Therefore, care must be taken when administering hypertonic solutions.

Learn more about Osmosis in RBCs here:

https://brainly.com/question/31835073

#SPJ3

TOne possible conclusion that can be drawn about the activity of these two cells is that
(1) more active transport occurs in cell B than in cell A
(2) more active transport occurs in cell A than in cell B
(3) cell B uses some of the extra mitochondria to make food
(4) cell A is a plant cell since it has a cell wall Mitochondria Cell

Answers

Answer:

(2) more active transport occurs in cell A than in cell B

Explanation:

I suppose you meant the cells picture I attached.

(1) more active transport occurs in cell B than in cell A;

Active transport is the movement of molecules across a membrane from a region of lower concentration to a region of higher concentration. For this movement to occur, it requires cellular energy. From the diagram, cell B possess less mitochondria than cell A.

(2) more active transport occurs in cell A than in cell B;

From the above explanation, it is clear that cell A possess more mitochondria than cell B, active transport moves against a concentration gradient and therefore require energy which must be supplied by the cell. Due to this the cells capable of active transport usually have more mitochondria, in which respiration takes place than other cells.

(3) cell B uses some of the extra mitochondria to make food

From the diagram, it does not indicate the cell using any extra mitochondria to make food. Mitochondria produce energy by cellular respiration.

(4) cell A is a plant cell since it has a cell wall Mitochondria Cell

Animal cells do not have a cell wall but have a cell membrane. Plant cells have a cell wall composed of cellulose as well as a cell membrane; however, from the diagram, this information is invalid.

Genetic variation _____. a. must be present in a population b. before natural selection can act upon the population c. arises in response to changes in the environment d. is created by the direct action of natural selection

Answers

Answer:

B.

Explanation:

This is the change in the amino acid sequence of DNA of an organism.

It is one of mechanisms of  Natural selection. Variation  makes some organism to develop selective advantages over others in the same population. Therefore they have resistance to selection pressure and more natural selected   above  others organisms in the same population

Final answer:

Genetic variation must be present in a population before natural selection can act upon the population.

Explanation:

Genetic variation must be present in a population before natural selection can act upon the population. It refers to the differences in the genetic material (DNA) among individuals within a population or species. The presence of genetic variation provides the raw material for natural selection to work on, as it allows certain traits to be favored or disadvantaged based on their fitness in a given environment.

Learn more about Genetic variation here:

https://brainly.com/question/32072667

#SPJ3

You decide to try your hand at canning pickles. You immerse freshly picked cucumbers in a solution that has a solute concentration twice that found in the cucumber cells. You allow your preparation to cure for several months in a sealed jar. When you later open the jar, you find that the fluid surrounding the pickles is more dilute than when you started.This change in concentration is due to_____.

Answers

Answer:

Exosmosis of water from cucumber cells into the fluid.

Explanation:

The solute concentration of the fluid in which cucumbers were immersed was higher than that of the cucumber cells. This means that the fluid was hypertonic with respect to the cucumber cells. This allowed movement of water from the hypotonic cucumber cells towards the hypertonic surrounding fluid. The process is called exosmosis with respect to cucumber cells. The loss of water from the cucumber cells by the process of osmosis diluted the surrounding fluid.

What is the expected outcome if DNA from an ampicillin resistant organism is incorporated into an ampicillin sensitive organism by transformation and then the resulting organisms are allowed to reproduce on agar containing ampicillin?

Answers

Answer:

Only transformed cells will grow on agar containing ampicillin.

Explanation:

If the DNA from an ampicillin-resistant organism is incorporated into an ampicillin sensitive organism then the transformed ampicillin sensitive organism will get ampicillin resistant gene.

So when this transformed organism will allow growing on the agar containing ampicillin then this transformed organism will easily grow and reproduce on agar containing ampicillin because now it has an ampicillin-resistant gene which will protect it from ampicillin antibiotic. So the transformed cell will grow on agar containing ampicillin.

Which perspective assumes that human behavior may have developed in certain directions because it served a useful function in preserving the species?

Answers

Answer:

656

Explanation:

If the period of a wave decreases, its frequency must

A. decrease
B. halve
C. stay the same
D. increase

Answers

Answer:

D - increase

Explanation:

Answer: Its frequency increases

Explanation:

Period is the time taken for an object to complete a full cycle or revolution.

It is the inverse of frequency

i.e Period = 1/frequency

Thus, decrease in period is proportional to an INCREASE in frequency

A student preparing for a hike wants to pack a snack that has biomolecules that provide quickly available Energy but few excess calories.Which nutrición label list the best combination of biomolecules the provide quickly available energy while providing the fewest calories form other types of moleculee

Answers

Answer:d

Explanation:

Alan is a 47-year-old man who has no documentation of a primary series of tetanus-containing vaccine. Which of the following would be an appropriate primary series for Alan?

Answers

Explanation:

For people 7 years of age and older who have not been previously immunized against tetanus, WHO recommends a 3-dose primary vaccination series with tetanus-diphtheria containing vaccine followed by 3 booster doses, to be protected throughout life.

Answer:

The appropriate primary vaccination series is as follows:

First dose - week oneSecond dose - 4 - 8 weeks after the first doseThird dose - 6 - 12 months after the second dose

Gap junctions allow direct communication or ionic flow between adjacent cells for a(n) ________ synapse, while synapses that use neurotransmitters to signal from the presynaptic to postsynaptic cell are called ________.

Answers

Answer:

1. Electrical synapse

2. Chemical synapse

Explanation:

The nervous system is composed of the billions of neurons which communicate with each other through the generated nerve impulse. The transmission of the nerve impulse depends on the movement of ions which generate an electric impulse.

The impulse is passed from one neuron to another neuron through the neuronal gaps called synapses.

The neurons which transmit the signal in the form of the electrical signal through the gap junctions between the neurons which allow the direct transmission of the signal. The synapse in such neurons is known as an electrical synapse.

The neurons which transmit the signal by converting the electrical signal to chemical signal in the form of neurotransmitter contain the synapse called chemical signals.

Thus, Electrical synapse and Chemical synapse are correct.

Final answer:

Gap junctions enable direct electrical communication between cells in an electrical synapse, often found between certain interneurons and glial cells, whereas chemical synapses use neurotransmitters to facilitate intercellular communication.

Explanation:

Gap junctions allow direct communication or ionic flow between adjacent cells for a(n) electrical synapse, while synapses that use neurotransmitters to signal from the presynaptic to postsynaptic cell are called chemical synapses. Gap junctions are created by pairs of hemichannels, which are made up of connexin proteins.

These junctions permit the flow of cations, anions, and even small molecules such as ATP between cells, allowing for direct electrical signal propagation. Electrical synapses facilitated by these gap junctions are vital for certain interneurons in the brain and the retina as well as between glial cells like astrocytes. Whereas chemical synapses involve the release of neurotransmitters from the presynaptic cell which then bind to receptors on the postsynaptic cell, initiating a response.

During which phase does the cleavage furrow start forming

Answers

Answer:

EARLY ANAPHASE

Explanation:

A cleavage furrow is a division which occurs in a cell's surface before cell division. It begins with cell's “pinching” its cell membrane and cytoplasm down the middle resulting in formation of two daughter cells.

Animal cell cleavage furrow is as a result of a ring of actin microfilaments known as the contractile ring, formed during EARLY ANAPHASE. The resultant bridge is divided and rearranged to yield two identical daughter cells when cytokinesis is occurring.

The bacteria grown in Luria broth with only lactose were expected to: Select one: a. Grow much faster than those grown in Luria broth and glucose. b. Mutate at a higher frequency than those grown in luria broth and glucose. c. Search for another carbon source. d. Show marked B-galactosidase activity. e. Show no B-galactosidase activity.

Answers

Answer:

Option D is correct

Explanation:

Luria broth contains yeast concentrate so it would show a marked B- galactosidase activity which is an enzyme that catalyzes the hydrolysis of B- galactosides including lactose and it is the first step of lactose fermentation.

Answer:

D. Show marked B-galactosidase activity.

Explanation: Bacteria are Microorganisms which can be very infectious.

Luria broth also called luria bertani broth, lysogenic broth are very rich Nutrition where certain Bacteria grow it is used generally for bacterial cultivation and growth, it has been known to support the growth of many bacteria such as Escherichia coli to an optical density of up to 600nm. Industrially,it is widely used for cultivation of Escherichia coli species.

A researcher is studying phases of the cell cycle in a population of cells during which there is an increase in the DNA content. This stage is most likely:

Answers

Answer:

Interphase

Explanation:

The cell cycle is the series of events that occurs in a cell leading to its division. It is characterized by two main phases viz: Interphase and the Mitotic (M) phase.

The Interphase also called the resting phase is the phase that occurs between two successive divisions of the cell. It is that time where the cell prepares, grows and duplicates its genetic material (DNA). The duplication or replication of DNA occurs specifically in the S-phase or Synthesis phase of the interphase, in which the molecules of DNA in the chromosomes doubles, hence, increasing its content.

It is pertinent that DNA doubles in the cell prior to division (mitosis) because each resulting daughter cell needs to contain an equal and correct amount of genetic material as the parent cell.

Therefore, according to the question, the cell will likely be at the Interphase stage of the cell cycle since Its genetic material has increased.

The semilunar valves of the heart open at the onset of the ejection period. Approximately what percentage of the stroke volume is ejected during the first quarter of systole?

Answers

The percentage of the stroke volume is ejected during the first quarter of systole will be approximately 60% to 65%

Explanation:

The time interval between the atria contraction and the relaxation of ventricles are called as a Cardiac cycle. Systole denotes the heart contraction during the blood pumping. Diastole refers to the heart relaxation when the blood is filled in the heart chambers. The total blood is not fully pumped by the ventricles.

Instead they will pump only a proportion of blood in each of the cardiac cycle.  The ejection fraction refers to the proportion of the intraventricular volume that is received as a output in circulation process. A human with normal heart functioning can have approximately 60-65%. This is known to be stroke volume. The blood volume that is ejected is strove volume.

Karen falls down a flight of stairs and suffers spinal cord damage due to hyperextension of the cord during the fall. The injury results in edema of the spinal cord with resulting compression of the anterior horn cells of the spinal region. What signs would you expect to observe as a result of this injury?

Answers

Answer:

The spinal cord plays an important role in the organisms as all the nerves are extended from the spinal and the important component of the central nervous system.  The spinal cord plays an important role in the reflex action as well.

The spinal cord control the movement and functioning of the motor neurons. The injury in the spinal cord can cause the problem in sitting, standing or walking. The control of the skeletal muscles  of the lower limb of the body gets disturb during the spinal cord injury.

Final answer:

Following a fall resulting in spinal cord damage and compression of the anterior horn cells, Karen is likely to exhibit muscle weakness, loss of fine motor skills, and potentially paralysis in the muscles serviced by the affected spinal region. These symptoms stem from the impaired transmission of nerve impulses from the damaged cells to the muscles.

Explanation:

Karen's spinal cord damage due to hyperextension during a fall, resulting in edema and compression of the anterior horn cells, is a serious medical condition. The anterior horn cells, located in the gray matter of the spinal cord, are primarily responsible for initiating voluntary muscle contractions. When these cells are compromised, the most prominent signs one would expect to observe include muscle weakness, loss of fine motor skills, and in severe cases, paralysis of muscles in the affected regions. These symptoms occur because the damaged anterior horn cells cannot effectively transmit nerve impulses to the muscles, disrupting the neural circuitry that facilitates voluntary movement.

Moreover, the extent and severity of these symptoms largely depend on the specific segment of the spinal cord that is damaged. Since the spinal cord operates as the primary conduit for sending signals between the brain and the body, injuries to different segments can affect bodily control and sensation in various ways. Thus, immediate medical assessment and intervention are crucial to mitigate the impact of such injuries and enhance the chances of recovery.

Pedalfer soils would most likely be found _____. A. in the eastern half of the United States B. in the dry areas of the western United States C. in a tropical rain forest D. on an island close to the equator

Answers

Answer:

Pedalfer soils would most likely be found in the eastern half of United States

Explanation:

The climate in the eastern half of the US is humid and rainy. When leaves of trees fall off during an extreme rainfall event, leaves mix up with soil to produce padalfer soil. The word padalfer is based on the two elements is (aluminum and ferrous) that are commonly present in this soil type. These elements join the soil because of these biogeochemical cycles. This is also the reason that the word "padalfer", contains Al and Fe.

A young student is trying to recapitulate an experiment discussed in the text. She introduces single-celled green algae into a petri dish containing predatory protists. After several generations, what will she observe?

A)The protists will produce multicellular colonies.
B)Green algae will form multicellular colonies.
C)Green algae will remain unicellular (i.e., there is no benefit to forming multicellular structures).
D)Both protists and green algae will remain unicellular.
E)None of the answer options is correct.

Answers

She will observe that Green algae will form multi-cellular colonies.

Explanation:

There are different advantages that can be obtained from the  characteristics of multicellularity of algae. The main thing that is very essential for the the nature of multicellularity is the coordination and cell interaction in algae. The cell communication can be achieved by the transfer of materials of cytoplasm.

The cellcommunication can also be achieved through the molecules that are diffusible in nature. these are are the unique and common characteristics of the organisams that are multicellular. They will be following a varied pattern of cell growth and cell division to form colonies.

Which structure in a stained cheek cell would most likely be visible when viewed through the high-power objective of a compound light microscope?

Answers

Answer:

The nucleus.

Explanation:

Because it gets stained

The structure in a stained cheek cell that would most likely be visible when viewed through the high-power objective of a compound light microscope is the nucleus, as the nucleus can be visible with certain types of the stain.

What is the importance of the nucleus?

One of the most important functions of the nucleus is to store and replicate the cell's genetic material, which ensures that the genetic information is passed on from one generation of cells to the next through DNA replication, it also plays a key role in the expression of genes, which is the process by which the instructions in the DNA are used to produce proteins and other molecules through transcription, translation, etc.

Hence, the structure in a stained cheek cell that would most likely be visible when viewed through the high-power objective of a compound light microscope is the nucleus, as the nucleus can be visible with certain types of the stain.

Learn more about the importance of the nucleus here.

https://brainly.com/question/17704494

#SPJ5

While in South America, you come across what you think are two groups of birds in the same location. They are nearly identical aside from their color. After years of observation, you conclude that the birds eat similar diets and share similar behaviors but do not reproduce with each other. These groups of birds appear to be an example of:__________A) a single biological species.B) ring species.C) two different species on the basis of reproductive behavior.D) two different species on the basis of the ecological niche occupied.E) a single ecological species.

Answers

Answer: The answer is option C) two different species on the basis of reproductive behavior

Explanation:

This situation observed in South America is a good example of Sympatric speciation.

Where, two organisms similar in many respects by

- occurring in the same territory, differing ONLY as two different species because they DO NOT interbreed - thus, becoming different species on the basis of reproductive behavior.

So, option C is the answer

Many researchers think that the first eukaryotic cells obtained energy for life-sustaining functions from organic compounds. Given this information, which of the following organelles most likely appeared last in eukaryotic cells?
a.plasma membrane
b.chloroplast
c.ribosome
d.nucleus

Answers

Answer: Chloroplast

Explanation:

The presence of chloroplast would have been the last organelle which appeared in the eukaryotic cell. Chloroplast helps in photosynthesis which means prepare food from the inorganic compounds.

But here the cell obtains energy from the organic compounds which states that there is no need of chloroplast in the cell as they obtain energy by hetero tropic mode of nutrition.

Hence, chloroplast is the correct answer.

20 different ___ ___ link together to form chains. A protein is composed of one or more of these ___ chains which are twisted and folded into a particular shape.

Answers

Answer: Amino acids; peptide

Explanation:

20 different AMINO ACIDS link together to form chains. A protein is composed of one or more of these PEPTIDE chains which are twisted and folded into a particular shape.

There exists 20 amino acids capable of forming protein in the Human body. At least two amino acids are joined together by a peptide bond to form polypeptide chains that are then held together by hydrogen bonds in twisted alpha helical structures to form proteins.

Answer:Amino acid, polypeptide/polynucleotide chains

Explanation: Amino acids are usually the building blocks of protein hence,every protein is made up of one or more amino acids.

A protein consist of one or more polypeptide chain that is folded into a helix shape. This shape is to prevent the easy degradation of the components that makes up the polypeptide because it is water loving and can easy degrade.

Neurons are the central building blocks of the nervous system. A neuron’s outer surface is made up of ______________ which allows smaller molecules and molecules without an electrical charge to pass through it, while stopping larger or highly charged molecules.

Answers

Answer:

semipermeable membrane

Explanation:

Neurons are the cells of the nervous system and have the plasma membrane as their outer covering. Their plasma membrane is also made up of two layers of phospholipids and the proteins are embedded in it. Therefore, the plasma membrane of neurons is a semipermeable membrane as charged and polar substances can not cross its nonpolar core made up of the hydrophobic tails of the phospholipids.

Similarly, the substances with a larger size can also not move freely across it. A semipermeable membrane allows only certain substances to move through it.

A gene is considered to be non-Mendelian in its inheritance pattern if it seems to "violate" Mendel's laws. Which of the following would then NOT be considered non-Mendelian?
A gene whose expression varies depending on the gender of the transmitting parent
A gene transmitted to males from the maternal line and from fathers to daughters
A gene transmitted via the cytoplasm or cytoplasmic structures
A gene derived solely from maternal inheritance
A gene transmitted by a virus to egg-producing cells

Answers

Answer:

A gene transmitted to males from the maternal line and from fathers to daughters.

Explanation:

Gregor Mendel through his research on pea plants, came up with three laws which are:

The Law of Segregation of genes: Each inherited trait is defined by a pair of  gene alleles. Genes are randomly separated to the sex cells so that sex cells contain only one allele of the pair.  The Law of Dominance: An organism with alternate forms of a gene will express the form that is dominant. The Law of Independent Assortment: Genes for different traits are sorted separately from one another so that the inheritance of one trait is not dependent on the inheritance of another.

In His work, he established the basic patterns of inheritance and it wasn't until after his death that sex linked inheritance patterns were identified.

He believed that a pair of genes called alleles, were transmitted, each allele from one parent and both alleles transmitted from each parent constituted the complete pair in the offspring.

However, if different variants of the same gene were inherited from both parents, the dominant gene is expressed in the offspring (phenotype).

Since the basis of his work established genes being equally transmitted by both parents to offspring, the variations being due to dominance, genes transmitted from mother to son and from father to daughter, follows the Mendelian pattern of inheritance.

A PICC line is a short catheter inserted into the jugular vein. A PICC line is a catheter that allows for infusion of intravenous fluids without an infusion pump. A PICC line is a long catheter inserted through the veins of the antecubital fossa. A PICC line is a catheter that is used for emergent or trauma situations.

Answers

Answer:

A PICC line is a long catheter inserted through the veins of the antecubital fossa.

Explanation:

PICC (peripherally inserted central catheter) that are mainly used as a part of chemotherapy for the administration of the particular substances. This can be used for the long period of time in the individual.

The long catheter is inserted in the body through the skin mainly at the peripheral site of the body. This can be inserted for the weeks depending on the severity of treatment. The veins of the antecubital fossa is used for the insertion of the tube.

Thus, the correct answer is option (3).

Answer:

C

Explanation:

The cerebellum and basal nuclei are involved in regulating motor activity, starting and stopping movements, and coordinating postural movements.

A. True
B. False

Answers

Answer:

The correct answer is - True.

Explanation:

The cerebellum is the major part of the brain that receives the sensory information and regulate the motor movements. The information that is come from the various parts of the brain helps motor neurons to coordinate different functions such as speech, balancing, maintaining posture.

It is the part of the base of the brain which is responsible for the various functions such as coordination and body movements. It is made up of the four bunch of nerve cells.

Thus, the correct answer is - true.

Final answer:

The cerebellum coordinates body movements and balance, whereas the basal nuclei regulate motor activity, initiation and termination of movements, and postural adjustments, making the statement true.

Explanation:

The statement regarding the cerebellum and basal nuclei (also known as basal ganglia) is True. The cerebellum is located just below the cerebrum and at the back of the brain, resting on top of the brainstem. It plays a crucial role in coordinating body movements, including balance, and is instrumental in motor tasks that are learned through repeated practice, such as playing a sport or typing. It achieves this by receiving and integrating sensory feedback from various parts of the body through numerous nerve pathways. On the other hand, the basal ganglia are a group of structures in the brain that help to regulate motor activity, including the initiation and termination of movements, as well as postural adjustments, alongside facilitating self-motivation.

Damage to which portion of the limbic system results in loss of memory of recent events and difficulty committing anything new to memory?
a. Cerebellum
b. Substantia nigra
c. Thalamus
d. Hippocampus
e. Hypothalamus

Answers

Answer:

The correct option is D. (Hippocampus)

Explanation:

Hippocampus is known as the part of the brain and situated in the bottom middle section inner folds which are called the temporal lobe. The main function of the hippocampus is memory and learning. It plays an important role in retrieve two types of memory which are known as declarative memories and spatial relationship memories.

1) Declarative memories: It is related to events and facts such as learning how to memorize lines.

2) Spatial relationship memories: It is related to routes and pathways such as when a driver learns pathways through the city.

Final answer:

Damage to the hippocampus in the limbic system causes the loss of recent memories and impairs the formation of new memories. It is critical for memory consolidation, unlike the substantia nigra, which is in the midbrain and related to movement.

Explanation:

The portion of the limbic system that when damaged results in the loss of memory of recent events and issues with forming new memories is the hippocampus. The hippocampus is vital for the consolidation of information from short-term memory to long-term memory and in spatial memory that enables navigation. Damage to this area, as in the famous case of patient H. M., who had his hippocampi removed, can lead to severe memory impairment, where the ability to form new declarative (explicit) memories is lost.

Regarding the structures of the forebrain, the substantia nigra is not part of the forebrain; it is located in the midbrain and is involved in reward and movement. When examining other parts of the brain such as the cerebellum, it is worth noting that this area is associated with motor learning and classical conditioning but is not involved with memory consolidation like the hippocampus.

A scientist collects a spore from a new species of fungus and observes that this spore has a flagellum. What does the presence of a flagellum suggest about the lifestyle of this species?

Answers

The question is incorrect as it does not have the options which are:

Its spores are produced asexually. It is an endomycorrhizal fungus. It is aquatic. It relies on insects for spore dispersal. It is unicellular.

Answer:

It is aquatic.

Explanation:

The spores are the asexual reproductive units produced by the algae and fungi which helps in the dispersal of the species.

When the spores possess the flagella, the spores are known as the zoospores which are produced in the zoosporangium.

The zoospores are the characteristic of the aquatic fungi like Synchytrium which are thin-walled and germinate to form a new mycelium.

Thus, the fungi are aquatic is the correct answer.

Answer:

The answer is B

Explanation:

Hope it helps  :)

If you touch a hot stove, your spinal cord can prompt you to withdraw your hand without having to send the message all the way to the brain. This is due to what scientists call __________.

Answers

Answer:

The reflex arc

Explanation:

The reflex arc is a pathway in which sensory receptors sense the stimulus and the sensory neurons carry the sensory information to the spinal cord. Here, the spinal cord serves as the integrating center. It sends the motor information via motor neurons to the effector organs. This pathway followed by nerve impulses is called reflex arc in which the information is not sent to the brain for processing. This allows a quick generation of responses called reflexes. Touching a hot stove is sensed by the thermoreceptors of skin and the information follows the reflex arc to generate response.

Final answer:

The phenomenon described is a reflex arc, an automatic response to a specific stimulus that bypasses the brain to quickly prompt a reaction, like withdrawing a hand from a hot stove.

Explanation:

What you're referring to is what scientists call a reflex arc. A reflex arc is an automatic, involuntary response to a specific stimulus, such as pain from touching a hot surface. Unlike other types of nerve signals, the signals from a reflex arc don't need to go all the way to the brain to be processed. Instead, the signal goes to the spinal cord, which then sends a signal back to the muscles, prompting you to draw your hand away. This bypass of the brain helps speed up response time, which can be crucial in preventing injury.

Learn more about reflex arc here:

https://brainly.com/question/32286035

#SPJ12

If the mouse was in a wire cage and only the weights of the mouse, food, and water were considered, would you come to the same answer as in Part A?

Answers

Answer:

Here is the full question:

(A) If a closed container contains a mouse as well as enough food, water, and oxygen for the mouse to live for 3 weeks,

How much will the container weigh 1 and 2 weeks later after the  mouse has eaten, drunk and exercised (respiration is CO2 emission), and why?

(B) If the mouse was in a wire cage and only the weights of the mouse, food, and water were considered, would you come to the same answer as in (A) and why?

Explanation:

(A) The mouse will weigh the same. This is because solids, liquid, and gases cannot escape the closed container. All of the life processes involving reactions conserve the atoms involved. Some of those atoms will appear in the form of gases, some as solids, and others as liquids but all will be retained in the closed container.

(B) In a wire cage, gases can escape. This means that the weight will not be the same after 1 and 2 weeks. The weight would be less than the original weight of the mouse, it's food, and it's water.

Other Questions
A(n) 26000 kg freight car is rolling along a track at 3.3 m/s. Calculate the time needed for a force of 1150 N to stop the car. Answer in units of s. What is apoptosis? A. The proliferation of cytotoxic T-cells. B. The receptor on a cytotoxic T-cell that recognizes MHC molecules. C. The process of programmed cell death. D. A protein molecule that forms a pore in the membranes of infected cells. The practitioner is examining a client and notes that he has small, punctate skin hemorrhages on his abdomen and chest. This finding is suggestive of which of the following lab results?-Low platelets-Low red blood cells-Low white blood cells-Low neutrophils Can I get the correct answer for this please.Lorrie is playing a board game. She started her playing piece five spaces from the starting circle. During the remainder of the game, she advanced only one space per turn. Which of the following shows how the number of spaces, y, changes as the turn, x, changes In lines 19-24 the author's attitude toward the cat has a In which region of the United States are the majority of the country's fastest-growing metropolitan areas? What is another equation for y=3/4x+4 so it has many solutions Grey has two children, Ham (the eldest) and Ivy, both of whom predecease Grey-Ham is survived by a daughter, Jess, and Ivy by two sons, Kato and Lars. On Greys death, if the estate is distributed per stirpes each grandchild receives one-third of the estate. Jess receives one-half of the estate, and Kato and Lars each receive one-fourth. Jess receives the entire estate. the grandchildren receive nothing. what are the solutions of 3 x^2-x+4=0 Before the evolution of complex nervous systems, animals with very simple nervous systems, such as the nerve nets of cnidarians, could engage in all of the behaviors except __________ Which of the following model organisms is a multicellular worm usedto study the process of development? a)Saccharomyces cerevisiaeb) Caenorhabditis Which of the following serves as the justification for the periodic recording of depreciation expense? a. Association of efforts (expense) with accomplishments (revenue) b. Systematic and rational allocation of cost over the periods benefited c. Immediate recognition of an expense d. Minimization of income tax liability If n denotes a number to the left of 0 on the number line such that the square of n is less than [tex]\small \frac{1}{100}[/tex], then the reciprocal of n must be _________. Solve the rational equation quantity 3 times x plus 2 end quantity divided by 5 equals quantity 2 times x minus 1 end quantity divided by 3. x = 1 x = 3 x = 6 x = 11 7p-30p + 8 how do you factor this trinomial At a certain college, 30% of the students major in engineering, 20% play club sports, and 10% both major in engineering and play club sports. A student is selected at random. What is the probability that the student is majoring in engineering? For the right triangle shown, the lengths of two sides are given. Find the third side. Leave your answer in simplified,radical form.b = 9, C = 16 Governmental projects should follow the __________ rules to deliver specific deliverables, artifacts, and products. Sometimes called _____, books that expressed the diversity of voices and experiences of late-20th-century America were celebrated as a way to promote cross-cultural understanding by examining the different value systems, histories, traditions, and speech patterns of people in America. Identify the correct sentence. A. His cake tastes especially well. B. His cake tastes excellently. C. He bakes both cake and pie good. D. His cake tastes especially good. Steam Workshop Downloader